ARTICLES

Peanut Aflatoxin and Genomics Research in China: Progress and Perspectives

Authors: Boshou Liao , Weijian Zhuang , Ronghua Tang , Xinyou Zhang , Shihua Shan , Huifang Jiang , Jiaquan Huang

  • Peanut Aflatoxin and Genomics Research in China: Progress and Perspectives

    ARTICLES

    Peanut Aflatoxin and Genomics Research in China: Progress and Perspectives

    Authors: , , , , , ,

Abstract

Peanut is an important oil and food crop in China with a unique role in agricultural development and food security. Aflatoxin contamination in peanut, normally more serious in southern parts of the country, is a crucial factor affecting sustainable development of the peanut industry. Extensive efforts have been made at several institutions in China for aflatoxin management and related genomics research. Several local peanut germplasm lines have been identified as resistant to seed infection by Aspergillus flavus or aflatoxin production. Two AFLP markers have been identified that are linked with resistance to seed invasion and one was converted into a SCAR marker for more efficient breeding application. Several new peanut cultivars with improved productivity and possessing resistance to aflatoxin contamination are extensively used in production. Integrated management approaches have been recommended to farmers based on agro-ecological characteristics in different regions. More recently, molecular techniques have been extensively used in genetic diversity assessment, investigation of genetic relationships among different germplasm groups, marker development, identification of interspecific genome introgression, gene cloning and function analysis, and genetic transformation of important traits concerning productivity, quality and food safety of peanut. Special emphasis has been placed on resistance to aflatoxin, bacterial wilt, foliar diseases and fatty acid desaturase. Perspectives of peanut genetic improvement and further research priorities are also discussed.

Keywords: peanut, aflatoxin, resistance, genomics, genetic transformation

How to Cite:

Liao, B. & Zhuang, W. & Tang, R. & Zhang, X. & Shan, S. & Jiang, H. & Huang, J., (2009) “Peanut Aflatoxin and Genomics Research in China: Progress and Perspectives”, Peanut Science 36(2), p.21-28. doi: https://doi.org/10.3146/AT07-004.1

1493 Views

432 Downloads

Published on
01 Jan 2009
Peer Reviewed

Introduction

Peanut or groundnut (Arachis hypogaea L.) has been an important oil and food crop in China, and extensively grown in most provinces. Currently, China is the largest country worldwide in terms of annual peanut production, consumption, and international trade (Liao, 2003). During 2002–2006, the average annual sowing area under the crop was 4.93 million ha and the production was 14.32 million t. (FAO, 2002–2006). About 55% of the production is crushed for oil, 30% used for direct consumption or for various food processing, and 7% exported. Among the major oilseed crops in the country, peanut has obvious advantages in terms of crop yield, oil yield and crop value to the farmer as compared with soybean and rapeseed. However, peanut supply in China is still insufficient because of increased demand for both peanut oil and edible peanuts. Further increases of peanut production will be needed to meet the increased market demands.

With the growth of peanut production and human consumption, aflatoxin contamination in peanut products has attracted more concern. Aflatoxins are secondary metabolites of Aspergillus flavus (Link) and A. parasiticus (Speare) (Mehan et al., 1991), and are among the most carcenogenic mycotoxins in nature. Peanut is a crop highly susceptible to Aspergillus infection and consequent aflatoxin contamination. Traditionally, Chinese peanuts for the export trade were mostly from the northern growing regions while those from the central and southern regions were rarely exported due to higher aflatoxin contamination (Sun, 1998; Liao, 2003). In many places, aflatoxin could be detected in nearly 50% of the samples of peanuts or peanut products (Xiao, 1996). Obviously, the warm climate in the subtropical regions encourages aflatoxin contamination (Liao, 2003). Moreover, the expanse of the peanut industry also worsens the contamination problems because limited facilities are available for proper and timely treatment of peanuts during harvesting, storing, and processing. Therefore, even in the northern growing regions aflatoxin contamination has become problematic for the industry during recent years. Correlation of aflatoxin exposure with higher incidence of human liver cancer has been reported in certain locations in southern parts of the country (Yin, 1983; Zhang and Huang, 1992). The social and economical importance of aflatoxin contamination in the food and and animal feed chains is widely acknowledged (Liao and Holbrook, 2006). Management of aflatoxin contamination is crucial for sustainable development of the peanut industry.

Genetic improvement for host resistance in peanut to seed colonization by the aflatoxigenic fungi species such as A. flavus and A. parasiticus and aflatoxin formation has been regarded as a valuable approach for reducing contamination in peanut even though genetic resistance is unlikely to completely resolve the problem (Liao and Holbrook, 2006; Mehan, 1986; Mehan et al., 1991). Genomics is an important research area crucial for crop improvement, but at present the genomics research in peanut is not developed enough to be useful in solving the aflatoxin problem. In China, several institutions and universities are involved in research on aflatoxin and genomics. This paper reviews the recent research progress on peanut aflatoxin management and related genomics towards addressing food safety and enhancing productivity.

Aflatoxin and Host Plant Resistance

Recent status of aflatoxin contamination

Aflatoxin contamination in peanut could be influenced by several factors (Hill et al., 1983; Liao, 2003). As the natural conditions and agricultural systems in different locations in China vary dramatically, aflatoxin contamination extent in peanut could be very different across locations and seasons. Limited investigation on the toxigenicity of strains of A. flavus from various locations indicated that the most toxigenic strains are from Guangxi in South China and those with the least toxigenicity were from Gansu in Northwest China (Xiao, 1996). Zhuang (pers. comm.) also observed differentiation among A. flavus strains in toxigenicity collected from Fujian Province. In general, aflatoxin contamination in peanut has been more serious in southern parts of the country versus the northern producing regions (Liao, 2003). In particular, peanut oil was more contaminated than peanut food, especially in the southern regions. Recently, Sun (pers. comm.) investigated aflatoxin contamination in peanuts in different locations of Shandong Province and concluded that less contamination was found in the samples. A survey of aflatoxin contamination of peanut and peanut products for export trade from northern China also reported low contamination. In a recent investigation, aflatoxin B1 was detected in 13% of 76 samples collected, and about 5% of the samples had aflatoxin B1 concentrations higher than the European Union permission standard (≤2 µg/kg) (Zhang, unpubl. data). Most contaminated samples were shelled peanuts rather than unshelled pods, indicating that the shelling processing may have at least partially caused the problem (e.g., a small scale sheller may have rehydrated the pods during processing). However, Xu et al. (2006) reported that aflatoxin B1 was detected in 80% of peanut samples collected from local markets in Nanjing, ranging from 0 to 58.25 µg/kg with an average of 0.72 µg/kg. Contamination of peanuts in the small scale domestic markets has been relatively higher than those being exported (Liao, 2003). A better system is needed for monitoring the contamination in different locations with an emphasis in the south.

Screening germplasm for resistance to aflatoxin

More than 7000 accessions of cultivated peanut have been assembled in China (Liao and Holbrook, 2006). Among these peanut accessions, about 2400 have been tested for their reaction to infection by Aspergillus or aflatoxin production (Jiang et al., 2002, 2005; Xiao et al., 1999a). Modifications of screening techniques for resistance to aflatoxin formation have been used in breeding populations (Xiao et al., 1999b). During the past two decades, extensive screening work has been conducted at the Oil Crops Res. Instit.(OCRI) of Chinese Acad. of Agric. Sci. (CAAS) in Wuhan, the Crop Res. Instit. (CRI) of Guangdong Acad. of Agric. Sci. in Guangzhou, the Cash Crops Res. Instit.(CCRI) of Guangxi Acad. of Agric. Sci. in Nanning, the Fujian Agric. and Forestry Univ. (FAFU) in Fuzhou, and the Shandong Peanut Res. Instit.(SPRI) in Qingdao. Twenty eight peanut genotypes were identified with some resistance, including the confirmation of several previously reported in the USA and the International Crops Research Institute for the Semi-Arid Tropics (ICRISAT) in India (Jiang et al., 2005; Mehan, 1986; Mixon, 1986; Wang et al., 2003, 2004; Xiao et al., 1999a). Most genotypes resistant to seed infection and colonization belong to A. hypogaea subsp. fastigiata var. vulgaris and have small seeds (Jiang et al., 2005). Xiao et al. (1999a) reported that the two lines N1211 and N1322 had the lowest aflatoxin production under artificial inoculation conditions among 1517 peanut accessions screened. They also found that the resistance in these two genotypes was more stable across seasons than other entries tested. Lei et al. (2004) and Liao et al. (2003) reported that Taishan Zhengzhu and Zhonghua 6 (with resistance to bacterial wilt) were relatively resistant to aflatoxin formation under artificial inoculation conditions. The hybrid progenies of entries with bacterial wilt resistance were relatively more resistant to aflatoxin formation than progenies from parents susceptible to bacterial wilt (Wang et al., unpubl. data). Wang et al. (2003) found that several peanut lines showed resistance to aflatoxin formation in vitro after having been stored under conventional conditions for 4 yr such that the seed were no longer viable . They indicated that the durability of the resistance in these lines might be related to storage proteins. Jiang et al. (2006b) investigated persistence of seed coat resistance during storage and impact of intact testa on aflatoxin contamination among peanut genotypes with diverse reactions to infection of A. flavus. The results indicated that the resistance to A. flavus could persist for at least 7 mo in resistant germplasm lines under conventional storage conditions in Wuhan. No significant difference between the seed samples stored for 7 mo and freshly harvested ones were observed in terms of in vitro invasion ratio and infection index. However, the resistance could decline or be lost after 9 mo storage. The quick decline of the resistance was due to the change of environmental temperature. Peanut genotypes with high oil percentage were generally more susceptible to A. flavus invasion. Two genotypes with resistance and good seed quality, G845 and G8, were identified (Jiang et al., 2006b). Several resistant germplasm lines have also been identified in Guangdong (Li, 2006). Mechanisms of resistance to aflatoxin contamination also have been investigated (Liang et al., 2002; 2005).

Genetic markers for resistance to aflatoxin

Even though peanut genotypes have been reported as resistant to seed infection by Aspergillus, the progress in breeding for resistance has been slow due to various reasons, including the lack of a cost-effective method to identify resistance in segregating progenies. Hence, there is a need to develop a rapid and reliable indirect screening method for selection. Molecular markers could be an important selection tool for crop breeding. Lei et al. (2005a) reported two DNA markers closely linked with resistance to A. flavus infection using the Amplified Fragment Length Polymorphism (AFLP) technique based on bulked segregate populations derived from F2 progenies of Zhonghua 5 × J11 (J11 is resistant to seed infection). The two specific fragments linked with seed infection resistance were E45/M53-440 (about 440 bps) and E44/M53-520 (520 bps). The linkage distance of the former marker to the resistant gene was 6.6 cM, while that of the latter was 8.8 cM. Twenty peanut genotypes with resistance to infection of A. flavus and seven susceptible genotypes were used to verify the reliability of the resistance markers, and high correlations between the molecular markers and the resistance screening were observed. To provide a more effective molecular assisted selection tool for breeding, the E45/M53-440 band was isolated from the PAGE gel and sequenced. According to the sequencing results, four primer pairs were designed for SCAR (Sequence Characterized Amplified Region) analysis, from which the primers D1 (GGATGGCTAGATTATTGCCGTAT) and D2 (AATTCATGTCCCTAGTGGCTGAT) showed correlations to the screening results and AFLP analysis. The amplified 412bp products were sequenced and corresponded to the sequence of marker E45/M53-440. Hence, it was confirmed that the AFLP marker E45/M53-448 was successfully converted to a SCAR marker, named as AFs-412. For confirming potential application of the AFLP and SCAR markers in the other resistant genotypes, 20 peanut accessions with resistance to seed infection by A. flavus and seven susceptible ones were selected for AFLP and SCAR analysis. The specific band was found in 16 of 20 resistant genotypes whereas it was not found in any of the susceptible ones (Lei et al., 2006). The marker E45/M53-440 and AFs-412 could be used for a marker assisted selection breeding program.

Breeding for resistance

Genetic enhancement for resistance to infection of mycotoxin-producing Aspergillus and to aflatoxin formation in peanut seeds has been recognized as a valuable approach for reducing contamination, even though the available resistance may not completely resolve the problem. Progress has been made on selecting resistant germplasm and cultivars in China. Several elite peanut germplasm lines with resistance to seed invasion and aflatoxin formation have been identified and used in breeding.

At OCRI, a new cultivar, Zhonghua 6, with resistance to aflatoxin formation and bacterial wilt has been developed (Liao, 2003). In seed inoculation tests under laboratory conditions across years, Zhonghua 6 had a reduced aflatoxin content which was only 10% or less of the susceptible control. To date, it has the highest level of resistance to aflatoxin formation among the improved peanut cultivars. Very low natural contamination of aflatoxin in Zhonghua 6 in farmers' fields has also been observed. This cultivar has been widely cultivated in eastern Hubei Province in central China where bacterial wilt is a major problem. Several breeding lines involving parents resistant to seed invasion or aflatoxin formation have been developed for further selection in both OCRI and other institutions.

Yueyou 9 is a new peanut cultivar with resistance to seed invasion of A. flavus. It was developed in the CRI of Guangdong Acad. of Agric. Sci. (Li, 2006). Under laboratory conditions, the seed infection ratio of Yueyou 9 was less than 19%, which is regarded as highly resistant, while the susceptible control was 100%. It has been released in Guangdong Province. Field trials are underway for investigating the role of resistance in reducing natural contamination in farmers' fields.

Kanghuang No 1 is an improved peanut cultivar with aflatoxin resistance released in Fujian Province in 2003. It is also moderately resistant to bacterial wilt. It was developed from the cross combination Yueyou 169 × ICGV94449A (Tang, pers. comm.).

Because nearly 60% of the peanuts are used for oil extraction (Liao, 2003), integration of aflatoxin resistance with high oil content in high yielding genetic backgrounds is of high priority. Unfortunately, no high oil germplasm line has been identified as resistant to aflatoxin and no combination of aflatoxin resistance with high oil content has been selected among numerous hybrid progenies in several breeding programs. This illustrates the need for more diverse germplasm with aflatoxin resistance for further varietal improvement of peanut.

Management of aflatoxin

Integrated management approaches are necessary for any production and processing system for minimizing aflatoxin contamination in peanut. In northern parts of China, preharvest contamination is generally less serious and more efforts are made to prevent contamination during harvest and storage (Liao, 2003). Rehydration during shelling is believed a key factor contributing to aflatoxin contamination even in seed lots being exported. In the central and southern parts of the country, the situation is variable and more complex. In upland fields, drought stress during the late growing stage in combination with high temperature may occur and lead to preharvest contamination. Various foliar diseases and soil-borne diseases could also worsen the contamination. Integrated management approaches including using peanut cultivars with resistance to aflatoxin contamination, drought tolerance, resistance or tolerance to other diseases and pests, proper irrigation, control of diseases and pests, timely harvest, quick drying after harvest, and control of conditions of storage and processing have been generally recommended to farmers and extension systems (Liao, 2003).

More recently, more farmers are using mulch cultivation technology in both paddy rice and upland fields for improving peanut yield in central and southern parts of China. As mulch could increase soil temperature and may cause heat stress during the maturing period, it may increase aflatoxin contamination. On the other hand, the drought stress could be alleviated by mulch and thus the preharvest contamination could be reduced. Therefore, the impact of mulch on aflatoxin contamination may be different at various locations. A recent investigation indicated that peanut seeds harvested from mulched cultivation supported less aflatoxin production in in vitro inoculation tests (Wang, unpubl. data), indicating that mulch cultivation could reduce the risk of contamination of peanuts if end-season drought stress exists. Based on this result, the mulch approach is highly recommended to farmers.

Peanut Genomics and Related Research

Genetic diversity assessment of peanut germplasm by molecular markers

There have been several reports on peanut genetic diversity at the molecular level (Han et al., 2004; He and Prakash, 1997; Hopinks 1999; Lei et al., 2005b; Wang et al., 2005b; Jiang et al., 2006a). Chen et al. (2003) reported genetic diversity of 32 peanut cultivars from different areas in China by AFLP fingerprinting analysis. The results showed that the similarity of all the plant samples was 35%, and the samples could further be divided into three groups by 45% similarity, indicating considerable diversity exists among these peanut genotypes.

Tang et al. (2007) assessed the diversity among different botanical types of the cultivated peanut through Single Sequence Repeat (SSR) profiling. They concluded that SSR markers are a useful tool for peanut because each botanical type of A. hypogaea could be further divided into sub-clusters based on genetic distance. Tang et al. (2007) also compared the effectiveness of SSR and AFLP markers and found that the clusters were mostly consistent with the current classification system based on morphological differentiation of A.hypogaea. Based on the genetic similarity revealed by SSR and AFLP markers, the diploid species, A. duranensis Krapov. and W.C. Gregory, was elucidated as one ancestor of A. hypogaea. Variety hirsuta was considered as the most primitive botanical type and var. vulgaris the most advanced type. Among the wild related species in genus Arachis, section Procumbentes was closer to section Arachis than other sections, and followed by Heteranthae, Rhizomatosae, Extranervosae, and Caulorrhizae (Tang et al., 2007). Jiang et al. (2006a) assessed genetic diversity of peanut genotypes with resistance to bacterial wilt with AFLP and SSR markers. They found the clusters generated through SSR profiling were more consistent with the morphological classification than through AFLP profiling. Zhang et al. (2006) also reported the effectiveness of SSR markers in identifying relationships among improved peanut cultivars.

Molecular marker development

Gao et al. (2003) reported methods for developing SSR markers in peanut. Wang et al. (2005b) tried to identify molecular polymorphism in peanut using the RGA (resistance gene analog) approach but the technology still needs refinement. Using hybridization enrichment, library construction along with the published SSR markers, Huang et al. (2006) found 44 polymorphic SSR markers effective to distinguish 12 peanut lines. Hong et al. (2007) reported an SSR marker (PM93/630-600) for deep purple testa color in peanut. Jiang et al. (2007) identified two SSR markers for resistance to bacterial wilt in peanut based on the results through resistance evaluation of F6 and F7 recombinant inbred lines (RILs) and DNA markers. They developed a map including eight linkage groups covering a distance of 603.9 cM containing 29 markers (28 SSR markers and one phenotypic marker). Xia et al. (2007) identified three AFLP markers linked with resistance to late leaf spot (LLS) in peanut. They found that the high level of resistance to LLS in an interspecific hybrid derivative, ICGV 86699 (A.batizocoi Krapov. and W.C. Gregory and A.duranensis Krapov. and W.C. Gregory were in the pedigree), was controlled by a single recessive gene based on resistance identification and analysis of segregation in the F2 population of Zhonghua 5 × ICGV86699. The three AFLP markers, E35/M51, E37/M48 and E41/M47, were also linked with each other on the same linkage group. The three markers could be detected in many interspecific hybrid derivatives with LLS resistance regardless of the cultivated parents, but were absent in the cultivated genotypes of valencia type with LLS resistance, indicating the genetic background of resistance in the wild related species was different from that of the cultivated species. Two AFLP markers (M3L3-460 and M8L8-645) for rust resistance in ICGV86699 have also been identified by Hou et al. (2007). It is generally believed that SSR markers are reliable (Furguson et al., 2004; Hopkins et al., 1999), and thus are commonly used for map based gene cloning in model plants such as Arabidopsis and rice. Due to the lack of genomic sequence information for peanut, there are too few SSR markers to construct a fine genetic map. With the large scale sequencing of peanut cDNA and DNA libraries, more data will be available and additional SSRs (or other cost effective markers) should become available for assisting peanut research.

Gene introgression into A. hypogaea from wild species

Molecular approaches have been used to detect genomic introgression from wild species of Arachis into the cultivated peanut. Wu et al. (2003) reported molecular identification of genomic ingression of A. cardenasii Krapov. and W.C. Gregory in 8126 (an interspecific hybrid derivative) using the Random Amplified Polymorphic DNA (RAPD) approach. They found that the RAPD primers including OPE2(GGTGCGGGA), OPF8(GGGATATCGG) and OPF20 (GGTCTAGAGG) could be used as markers of A. cardenasii intrgressions.

He et al. (2005) reported molecular evidence of gene introgression from wild Arachis species into the cultivated species. Among progenies derived from a cross with A. correntina (Burkart) Krapov. and W.C. Gregory as the pollen parent, several morphological traits and resistance to foliar diseases were similar with the diploid parent. Nineteen hybrid derivatives and their parents were tested for DNA variation by using SSR markers. Among 40 SSRs, three produced bands in A. correntina and the hybrids, but not in the cultivated parent, indicating genomic introgression had occurred. Yin et al. (2003) identified 27 polymorphic RAPD markers on the progeny of interspecific hybrids.

Gene cloning

The techniques for gene discovery have progressed well for many plants, and many research groups are conducting research for gene cloning and function analysis. Yin et al. (2007) reported a full-length sequence coding of a Δ12-fatty acid desaturase (FAD2) gene from peanut which was cloned into the plant expression vector, pRSETB, to generate recombinant plasmid pRSET/HO-A. This fatty acid desaturase expressed in high level in E. coli BL21(DE3) with induction of isopropyl-D- thiogalactopyranoside (IPTG).

Xie et al. (2007) also reported cloning of Δ12-fatty acid desaturase gene and construction of vectors. Genomic DNA was extracted from peanut leaves and two fragments of FAD2 were isolated by PCR application. Antisense FAD2-1 and FAD2-2 were cloned under the soybean oleosin gene promotor. The constructs were then transferred into Agrobacterium tumefaciens LBA4404 by the frozen-fusion method and have been used for peanut transformation. Based on the sequence of Δ12-fatty acid desaturase gene in GenBank (AF248739), the promoter region and partial exon of the gene in peanut (by using Yuhua 4 as template) were cloned, and inverted repeats of the Δ12-fatty acid desaturase gene fragment were further cloned into the plant binary vector pCAMBIA1301, and are ready for use in peanut transformation (Xie et al., 2007).

A full-length cDNA of an arachin gene was cloned from the immature peanut seeds cDNA library by plaque in situ hybridization. The cDNA contained an ORF (open reading frame) of 1886 nuclotides with a deduced protein of 536 amino acids. Results from northern blot analysis showed that the expression of the gene occurred at an early stage of seed development and increased dramatically over time (Quan et al., 2006).

A full-length resveratrol synthase gene of 1537 nucleotides was amplified from peanut by the Polymerase Chain Reaction (PCR) approach and cloned into vectors (pMD18-T and pBluescript II KS+). Analysis of the nucleotide sequence indicated that the sequence contained two exons and one intron and the reading frame encoded a protein of 389 amino acid whose molecular weight was 42,800. The amino acid sequence GVLFGFGPGLT was found at position 368-378 which was the family signature sequence for stilbene synthase (Wang et al., 2005a). In other research, cDNA of resveratrol synthase was cloned by over-hang extension PCR protocol using total DNA as the template. The PCR products were cloned into pBS-T vector and its sequence was determined. Then the cDNA of resveratrol synthase gene was subcloned into plant expression vector pBI121 and named pBI121L which could be used for plant transformation.

Two heteromorphic CaM genes in peanut were cloned by PCR reaction(Meng et al., 2004). The first strand of cDNAs was obtained by reverse transcription of the RNA from leaflets of peanut using primers synthesized according to the CaM gene sequence of barley. It was shown that the two different genes were all composed of 447 nucleotides encoding 148 amino acids. In addition, the two CaM genes, PCaM-1 and PCaM-2 shared 84% identity at nucleic acid sequence level and 97% identity on amino acid level with only five substitutions.

Using RACE (Rapid Amplification of cDNA End), Huang (2007, unpubl. data) isolated 15 copies of the resveratrol synthase gene from peanut line H2007. One of the genes has been expressed in E. coli.

Although much progress has been made in gene cloning in peanut in China, most of genes cloned were derived from homologous sequences in GenBank via bioinformatic analysis, and this tendency will continue in the near future. Other avenues such as construction of T-DNA insertion mutation library, EST sequencing, differential display and proteomics analysis may also help to discover functional genes in peanut. Functional gene isolation and promoter identification and isolation also is very important. In most cases, control of temporal and spatial expression of exogenous gene is crucial. For example, constitutive expression of a cold tolerance gene DREB1A led to the dwarf trait in Arabidopsis, while using a cold responsive promoter led to the enhanced cold tolerance and normal growth. In peanut, several promoters with the expression only in seeds have been cloned and their functional analysis is underway (Huang, pers. comm.).

Expressed sequence tag (EST) is a new strategy for isolating functional genes and has been extensively used in model animal and plant gene discovery. The ESTs are rapidly being deposited in GenBank. One EST project has been carried out in Bio-Tech Center of Shandong Acad. of Agric. Sci. located in Jinan, in which about 4000 ESTs from developing seeds of peanut have been sequenced. Another project at OCRI aiming to find disease resistance genes is also under way with a goal to sequence 60000 EST sequences from root, leaf and developing seeds (Huang, pers. comm.).

A peanut seed (including several developmental stages) cDNA library was constructed at the Bio-Tech Center of Shandong Acad. of Agric. Sci. (Wang, pers. comm.). To date, 10,000 ESTs were sequenced representing about 600 contigs and 2100 singlets, among which, 4406 ESTs have been submitted to the dbEST database (access number EE123340-EE127745). Two hundred and eighty cDNAs sequences were submitted to GenBank. From the EST sequences of 23 seed storage protein genes, there were six allergen genes identified. This information should be useful in research to down regulate the allergen expression and accumulation by antisense RNA or by RNAi techniques to produce a peanut with low allergen levels. Twelve genes involved in lipid metabolism and storage were also obtained from these ESTs.

Genetic transformation

Genetic transformation is of vital importance in molecular breeding, gene functional analysis, and gene discovery (Xu et al., 2007a). The first peanut transformation in China was reported in 1996 (Fang et al., 1996). Several transgenic peanut plants with gus gene were obtained by A. tumefaciens mediation. During the past decade, more research on peanut transformation has been conducted by various institutions. The mediation approaches in peanut transformation including particle bombardment, A. tumefaciens, pollen tube pathway, and ovary injection have been used (Xu et al., 2007a). Several target genes have been attempted in transforming peanut including peanut stripe virus (PStV) coat protein gene (Chen et al., 2004), chitinase gene and β-1,3-glucanase gene (Shan et al., 2003), Cowpea trypsin inhibitor (CpTI) gene (Xu et al., 2003) , Δ12-fatty acid desaturase gene (Xie et al., 2007), γ-tocopherol methyltransferase gene (Liu et al., 2005), hepatitis B surface antigen (HBsAg)(Chen et al., 2002), and resveratrol synthase (RS) gene (Xu et al., 2007b). Different tissues of peanut including leaflet, somatic embryo, embryo axis, cotyledon, and hypocotyl have been successfully used as explants in generating transgenic lines. However, further research efforts are needed for improving the transformation efficiency of peanut and more reliable plant regeneration protocols.

Conclusions and Perspectives

Peanut production in China is expected to further increase in the near future because peanut is competitive to other oilseed plants in many aspects. As the domestic vegetable oil production and supply in China is expected to remain in short supply during the next decade, the ratio of peanut crushed for oil should remain as high as around 60%. Since relatively high ratio of contaminated unrefined peanut oil samples from southern and central parts of China have been found (largely due to preharvest contamination and poor drying of the raw peanuts before processing), it is essential to strengthen management of contamination in peanut oil by using integrated approaches. More efforts are needed to screen and develop high oil germplasm with desirable resistance to aflatoxin and other biotic and abiotic stresses. Genetic manipulation of fatty acid components is important to enhance the nutrition quality and may also contribute to improve the reaction of peanut to aflatoxin contamination. Genomic approaches should be very promising in many aspects for genetic enhancement. EST sequencing, gene cloning, functional analysis and genetic engineering will concentrate on peanut quality and resistance enhancement.

Acknowledgements

The authors are grateful to Drs. Baozhu Guo and Corley Holbrook for revising the manuscript. The concerned colleagues who provided information for this review in several institutions are sincerely acknowledged.

Literature Cited

Chen K.R. , Xu Z.Y. , and Yan L.Y. 2004 Research on peanut transformation with coat protein gene of peanut stripe virus by particle bombardment. 133 – 138
In Proceedings of Plant Protection and Pesticides of Hubei and Hunan Provinces

Chen H.Y. , Zhang J. , Gao Y. , and Du H.L. 2002 Transforming HbsAg into peanut and detection of its immnogenicity. Letters in Biotechnonlogy 13 : 245 – 250 .

Chen Q. , Zhang X.P. , Li D.Y. , Terrefework Z. , and Lindstrom K. 2003 Genetic aspects of peanut cultivars in China revealed by AFLP analysis. Chinese Jour. of Appl. and Environ. Biol 9 : 117 – 121 .

Fang X.P. , Xu Z.Y. , Zhang Z.Y. , Yan L.Y. , and Chen K.R. 1996 Plant regeneration and agrobacterium-mediated gene transfer in leaflets of peanut (Arachis hypogaea L.). Oil Crops of China 18 : 52 – 56 .

FAO 2002–2006
http:/faostat.fao.org/production/crops/ .

Ferguson M.E. , Burow M.D. , Schulze S.R. , Bramel P.J. , Paterson A.H. , Kresovich S. , and Mitchell S. 2004 Microsatellite identification and characterization in peanut (Arachis hypogaea L.). Theor. and Appl. Genetics 108 : 1064 – 1070 .

Gao G.Q. , He G.H. , and Li Y.R. 2003 Development of microsatellite marker from cultivated peanut (Arachis hypogaea L.). Chinese Jour. Oil Crop Sci 25 : 30 – 33 .

Han Z.Q. , Gao G.Q. , Wei P.X. , Tang R.H. , and Zhong R.C. 2004 Analysis of DNA polymorphism and genetic relationships in cultivated peanut (Arachis hypogaea L.) Using Microsatellite Markers. Acta Agronomica Sinica 30 : 1097 – 1101 .

He G.H. and Prakash C.S. 1997 Identification of polymorphic DNA markers in cultivated peanut (Arachis hypogaea L.). Euphytica 97 : 143 – 149 .

He L.Q. , Tang R.H. , and Gao G.Q. 2005 Molecular evidence for gene introgression from wild species to cultivated varieties in peanut. Mol. Plant Breeding 3 : 815 – 820 .

Hill R.A. , Blankenship P.D. , Cole R.J. , and Sanders T.H. 1983 Effects of soil moisture and temperature on preharvest invasion of peanuts by the Aspergillus flavus group and subsequent aflatoxin development. Appl. and Environ. Microbiology 45 : 628 – 633 .

Hong Y.B. , Lin K.Y. , Zhou G.Y. , Li S.X. , Li Y. , and Liang X.Q. 2007 Genetic linkage analysis of SSR markers and the gene for dark purple testa color in peanut (Arachis hypogaea L.). Chinese Jour. Oil Crop Sci 29 : 35 – 38 .

Hopkins M.S. , Casa A.M. , Wang T. , Michell S.E. , Dean R.E. , Kochert G.D. , and Kresovich S. 1999 Discovery and characterization of polymorphic simple sequence repeats (SSRs) in peanut. Crop Sci 39 : 1243 – 1247 .

Hou H.M. , Liao B.S. , Lei Y. , Ren X.P. , Wang S.Y. , Li D. , Jiang H.F. , Huang J.Q. , and Chen B.Y. 2007 Identification of AFLP markers for resistance to peanut rust. Chinese Jour. of Oil Crop Sci 29 : 195 – 198 .

Huang X.Y. , Wang C.T. , Yang X.D. , and Xu J.Z. 2006 Analysis of DNA polymorphism in peanut cultivars using new microsatellite markers. Chinese Agric. Sci. Bull 22 : 44 – 48 .

Jiang H.F. , Chen B.Y. , Ren X.P. , Liao B.S. , Lei Y. , Fu T.D. , Ma C.Z. , Mace E. , and Crouch J.H. 2007 Identification of SSR markers linked to bacterial wilt resistance with RILs. Chinese Jour. Oil Crop Sci 29 : 26 – 30 .

Jiang H.F. , Liao B.S. , Ren X.P. , Lei Y. , Fu T.D. , Mace E. , and Crouch J.H. 2006a Genetic diversity assessment in peanut genotypes with resistance to bacterial wilt. Acta Agronomica Sinica 32 : 24 – 27 .

Jiang H.F. , Ren X.P. , and Wang S.Y. 2005 Evaluation for resistance to invasion and aflatoxin contamination caused by Aspergillus flavus in groundnut. Chinese Jour. Oil Crop Sci 27 : 21 – 25 .

Jiang H.F. , Ren X.P. , Wang S.Y. , and Liao B.S. 2006b Durability of resistance to Aspergillus flavus infection and effect of intact testa without injury on aflatoxin production in peanut. Acta Agronomica Sinica 32 : 851 – 855 .

Jiang H.F. , Wang S.Y. , and Ren X.P. 2002 Reaction of Groundnut germplasm to Aspergillus flavus invasion. Chinese Jour. Oil Crop Sci 24 : 23 – 25 .

Lei Y. , Liao B.S. , Wang S.Y. , Li D. , and Jiang H.F. 2005a Identification of AFLP markers for resistance to seed invasion by Aspergillus flavus in peanut (Arachis hypogaea L.). Acta Agronomica Sinica 31 : 1349 – 1353 .

Lei C.B. , Wan Y.S. , and Liu F.Z. 2005b Generally used molecular markers and their application in groundnut. Chinese Agric. Sci. Bull 21 : 36 – 40 .

Lei Y. , Liao B.S. , Wang S.Y. , Zhang Y.B. , Li D. , and Jiang H.F. 2006 A SCAR marker for resistance to Aspergillus flavus in peanut (Arachis hypogaea L.). Hereditas 28 : 1107 – 1111 .

Lei Y. , Wang S.Y. , Li D. , Jiang H.F. , and Liao B.S. 2004 Evaluation of resistance to aflatoxin contamination among peanut germplasm with resistance to bacterial wilt. Chinese Jour. Oil Crop Sci 26 : 69 – 71 .

Li S.L. 2006 Research progress of peanut resistance to Aspergillus flavus in Guangdong. Guangdong Agric. Sci 10 : 17 – 20 .

Liang X.Q. , Guo B.Z. , Holbrook C.C. , and Lynch R.E. 2005 Resistance to Aspergillus flavus in peanut seeds is associated with constitutive trypsin inhibitor and inducible chitinase and β-1-3-glucanase. Phytopathology 93 : S52 .

Liang X.Q. , Pan R.C. , and Zhou G.Y. 2002 Involvement of active oxygen generation and lipid peroxidation in susceptibility/resistance of peanut seed infected by Aspergillus flavus. Chinese Jour. Oil Crop Sci 24 : 19 – 23 .

Liao B.S. 2003 The Groundnut Hubei Press for Science and Technology Wuhan, China
ISBN 7-5352-2919-0/S.327.

Liao B.S. and Holbrook C. 2006 Groundnut. 55 – 60
In Genetic Resources, Chromosome Engineering, and Crop Improvement, Volume 4, Oilseed Crops Singh RamJ. CRC Press, Taylor & Francis Group FL, USA .

Liao B. , Lei Y. , Wang S.Y. , H.F. Jiang D.L.i. , and Ren X.P. 2003b Aflatoxin resistance in bacterial wilt resistant groundnut germplasm. Intern. Arachis Newsletter 23 : 24 .

Liu F.Z. , Wan Y.S. , and Wang H.G. 2005 Transformation of peanut with γ-Tocopherol methyl transferse gene via Agrobacterium Tumefaciens. Jour. Chinese Cereals and Oils Association 20 : 61 – 64 .

Mehan V.K. 1986 Varietal resistance in peanut to seed infection by Aspergillus flavus. Agron. Jour 65 : 560 – 562 .

Mehan V.K. , McDonald D. , Haravu L.J. , and Jayanthi S. 1991 The Groundnut Aflatoxin Problem: Review and Literature Database. Int. Crops Res. Inst
Semi-Arid Tropics (ICRISAT), Patancheru, A.P., India.

Meng Y.H. , Zhang J.C. , Shan S.H. , Li Y. , and Zhuang W.J. 2004 Cloning of two cDNAs encoding calmodulin from peanut (Arachis hypogaea L.). Chinese Jour. of Oil Crops Sci 26 : 27 – 30 .

Mixon A.C. 1986 Reducing Aspergillus species infection of peanut seed using resistant genotypes. Jour. Environ. Quality 15 : 101 – 103 .

Quan X.Q. , Yang H.X. , Shan L. , and Bi Y.P. 2006 Cloning and expression analysis of an arachin gene from Arachis hypogaea L. Jour. Anhui Agric. Sci 34 : 5483 – 5484 .

Shan S.H. , Zhuang W.J. , Guan D.Y. , Li C.J. , and Liu S.H. 2003 Genetic transformation of peanut (Arachis hypogaea L.) mediated by Agrobacterium tumefaciens. Jour. Peanut Science 32 : 1 – 6 .

Sun D.R. 1998 Breeding of Groundnut China Agricultural Press Beijing, China .

Tang R.H. , Gao G.Q. , He L.Q. , Han Z.Q. , Shan S.H. , Zhong R.C. , Zhou C.Q. , Jiang J. , Li Y.R. , and Zhuang W.J. 2007 Genetic diversity in cultivated groundnut based on SSR markers. Jour. Genetics and Genomics 34 : 449 – 459 .

Wang S.Y. , Lei Y. , Li D. , Xiao D.R. , and Liao B.S. 2003 Effect of storage period on infection of Aspergillus flavus and aflatoxin formation in groundnut. Jour. Peanut Sci 32 : 390 – 393 .

Wang S.Y. , Liao B.S. , Lei Y. , Li D. , and Ren X.P. 2004 Role of in vitro resistance to aflatoxin contamination in reducing preharvest aflatoxin contamination under drought stress in groundnut. Intern. Arachis Newsletter 24 : 38 .

Wang B.M. , Pan H.F. , Ye B.Y. , Huang Q. , Zhu J.M. , Chen R.K. , and Chen Y.Q. 2005a Cloning and sequence analysis of resveratrol synthase DNA from peanut (Arachis hypogaea L.). Jour. of Fujian Normal Univ. (Natural Science Edition) 21 : 56 – 60 .

Wang C.T. , Zhang J.C. , Yang D.X. , Xu J.Z. , and Yu S.L. 2005b The sequence-related amplification polymorphisms in cultivated peanut (Arachis hypogaea L.). Peanut Sci 34 : 11 – 15 .

Wu L.R. , Chen J. , Hu W.G. , and Miao H.R. 2003 A new peanut line created through hybridization with wild species Arachis cardenasii and RAPD identification. Chinese Jour. Oil Crop Sci 25 : 9 – 11 .

Xia Y.L. , Liao B.S. , Li J.N. , Lei Y. , Jiang H.F. , Cui F.H. , and Zeng X.P. 2007 Identification of AFLP markers linked to resistance to late leaf spot in peanut (Arachis hypogaea L.). Chinese Jour. of Oil Crop Sci 29 : 318 – 321 .

Xiao D.R. 1996 Statues and management of aflatoxin contamination in groundnut in China. 27 – 29
In Aflatoxin Contamination Problems in Groundnut in Asia, Proceeding of the First Asia Working Group Meeting 27-29 May 1996. Int. Crops Res. Inst. Semi-Arid Tropics (ICRISAT), Patancheru, A.P., India.

Xiao D.R. , Wang S.Y. , and Zhang H.L. 1999a Progress of research on resistance to aflatoxin contamination in groundnut. Peanut Sci.Technol 7 : 124 – 129 .

Xiao D.R. , Wang S.Y. , and Zhang H.L. 1999b Rapid identifying method for resistance to aflatoxin production in peanut. Chinese Jour. Oil Crop Sci 21 : 72 – 76 .

Xie J.X. , Cai N.B. , Shi X.G. , and Zhuang W.J. 2007 Cloning of peanut Δ12 fatty acid desaturase FAD2 and constructing of anti-sense expression vector. Jour. Peanut Sci 36 : 1 – 6 .

Xu H.Z. , Sun G.J. , Wang H.K. , Chen G.W. , Sheng J.L. , and Wang J.S. 2006 Determination of aflatoxins and fumonisins in the corn and peanut from market. Jour. Environ. Occup. Med 23 : 217 – 219 .

Xu Z.Y. , Liao B.S. , Yan L.Y. , and Chen K.R. 2007a Progress of transgenic peanut research. Chinese Jour. of Oil Crop Sci 29 : 489 – 496 .

Xu Y.F. , Ye B.Y. , Chen Y.Q. , Wang B.M. , Huang Q.H. , Lin Z.K. , and Chen R.K. 2007b Construction of the monocotyledon expression vector for the transforming of resveratrol synthase gene. Jour. Fujian Normal University (Natural Science Edition) 23 : 83 – 86 .

Xu P.L. , Shan L. , Liu Z.J. , Wang F. , Zhang B. , Bi Y.P. , and Zhuang C.K. 2003 Insect-resistant CpTI gene transferred into peanut (A.hypogaea L.) via Agrobacterium tumefaciens and regeneration of transgenic plantlets. Chinese Jour. Oil Crop Sciences 25 : 5 – 8 .

Yin D.M. , Cui D.Q. , and Jia B. 2007 Construction of a high efficient expression vector of Δ12 fatty acid desaturase in peanut and its prokaryotical expression. Jour. Genetics and Genomics 34 : 81 – 88 .

Yin D.M. , Zhang X.Y. , Tang F.S. , Dong W.Z. , and Zang X.W. 2003 Identification of wild Arachis species by RAPD. Henan Agric. Sci 11 : 15 – 17 .

Yin Z.B. 1983 A study on relationship between liver cancer and aflatoxin in Qidong County. Commun. of Medical Res 5 : 7 – 9 .

Zhang J.C. , Wang C.T. , and Yang X.D. 2006 SSR and STS polymorphisms in seed testing for peanut cultivars. Jour. Plant Genetic Resources 7 : 215 – 219 .

Zhang M.D. and Huang Z.Y. 1992 Relationship between liver cancer with aflatoxin. Chinese Jour. Preventive Medicine 3 : 12 – 14 .

Notes

    Author Affiliations

    1 Oil Crops Res. Inst. of Chinese Academy of Agricultural Sci., Wuhan, Hubei Province, 430062, China.

    2 Fujian Agric. and Forestry Univ., Fuzhou, Fujian, 350002, China.

    3 Cash Crops Res. Inst. of Guangxi Academy of Agric. Sci., Nanning, Guangxi, 530007, China.

    4 Cash Crops Res. Inst. of Henan Academy of Agric. Sci., Zhengzhou, Henan Province, 450002, China.

    5 Shandong Peanut Res. Inst., Qingdao, Shandong Province, 266100, China.

    *Corresponding author (e-mail: lboshou@hotmail.com)